in ,

Bewijs dat mRNA-vaccin van Pfizer het menselijk DNA blijvend verandert

Al meer dan een jaar vertellen onze betrouwbare “gezondheidsdeskundigen en factcheckers” ons dat mRNA-vaccins, waaronder en Moderna, zich niet in het menselijke cel-DNA integreren. Uit een nieuwe explosieve studie, gepubliceerd in Current Issues of Molecular Biology, blijkt echter dat de gezondheidsdeskundigen en factcheckers ongelijk hadden, schrijft Baxter Dmitry.

Uit laboratoriumonderzoek blijkt dat mRNA-vaccins zich WEL degelijk in het cellulair DNA van de mens integreren. In wezen veranderen de vaccins uw DNA voor altijd.

Wat het zegt is: laboratoriumstudies tonen aan dat mRNA zich WEL integreert in het cellulair DNA van de mens. Dat betekent dat een injectie met een Pfizer vaccin, ook al is het maar één keer genomen, het DNA van de aangetaste cellen blijvend verandert.

De mainstream media en factcheckers hebben zich erop toegelegd ons het tegendeel te vertellen:

Klik voor groot

Maar het brisante artikel uit Current Issues of Molecular Biology suggereert dat zij al die tijd aan het verspreiden zijn geweest.

Een nieuwe studie is uit: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov doet verslag:

Wat het zegt is: uit laboratoriumstudies blijkt dat het mRNA-vaccin zich WEL integreert in het menselijke cel-DNA. Dat betekent dat een injectie met het Pfizer vaccin, ook al is het maar één keer genomen, het DNA van de aangetaste cellen permanent verandert.

Wat het artikel laat zien is dat in vitro, met behulp van een menselijke levercellijn, het mRNA-vaccin van Pfizer gebruik maakt van een natuurlijk omgekeerd transcriptase enzym, LINE-1 genaamd, en dat de genetische code van het vaccin omgekeerd getranscribeerd wordt in het DNA.

Het verklaart ook dat het mRNA van het vaccin inderdaad naar de lever reist, als één van de voorkeursplaatsen (de andere plaatsen, zoals wij gehoord hebben, zijn de eierstokken en meer).

Wat betekent dit? Normaal gesproken doen onze cellen het omgekeerde: de celkern, waar het DNA zit, drukt bepaalde DNA-code uit op basis van de omstandigheden van de cel, en produceert natuurlijk, menselijk boodschapper-RNA. Dat boodschapper-RNA reist de celkern uit, waar het tot expressie komt in eiwitten die nodig zijn voor de celopbouw. Zo brengen groeiende organismen verschillende genetische programma’s tot expressie om spiercellen of hersencellen te kweken, enz.

Dit proces heet “transcriptie”.

Jarenlang stelde het Centrale Dogma van de Moleculaire Biologie dat de “omgekeerde transcriptie” – het verplaatsen van de genetische code van RNA terug naar de heilige celkern en het opnieuw coderen van het DNA – onmogelijk was. Uiteindelijk hebben de wetenschappers ingezien dat het onder verschillende omstandigheden wel mogelijk is. Het RNA-virus bijvoorbeeld is daartoe in staat en het herprogrammeert ons DNA om er kopieën van te maken. HIV is het virus dat AIDS veroorzaakt.

Om omgekeerde transcriptie te bewerkstelligen, zijn enzymen nodig die “omgekeerde transcriptases” heten. Eén daarvan heet LINE-1.

Blijkbaar, zo blijkt uit een studie, zorgt het Pfizer mRNA-vaccin ervoor dat cellen dat LINE-1 enzym produceren.

Nadat zij LINE-1 reverse transcriptase hadden zien toenemen, hebben zij getest op veranderingen in het DNA, om er zeker van te zijn dat zij niet in plaats daarvan het RNA oppikken.

De genetische code die zij oppikten is:

CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Wil iemand er BLAST op uitvoeren?

Vereenvoudigd

Zoals ik in antwoord op een vraagsteller heb uitgelegd:

Het mRNA-vaccin van Pfizer verandert onze genetische code, die bepaalt hoe onze organismen werken, die u van uw vader en moeder geërfd hebt. Nu is uw DNA veranderd ten opzichte van wat uw vader en moeder u gegeven hebben, door er een kleine mysterieuze “edit” van Pfizer aan toe te voegen.

Uw organisme werkt in overeenstemming met uw DNA-programma, en nu, wel, is dat programma gehackt en gewijzigd door Pfizer.

Kankercode

Gezien het feit dat het “spike-eiwit” Sars-Cov-2 een kankercode heeft van Moderna 2017 octrooi 9,587,003, is het absoluut noodzakelijk om uit te zoeken wat de implicaties zijn van deze omgekeerde transcriptie, en of de gevaccineerden nu een ongewenste genetische code in hun DNA ingebakken hebben gekregen.

Van bijzonder belang is of deze mRNA-geïnduceerde omgekeerde transcriptie de “kiembaan”, zoals eicellen en zaadcellen, aantast, en of het ook de foetus van zwangere moeders aantast.

Wij verzoeken u dit artikel wijd en zijd te herpubliceren, vanwege de grote implicaties voor onze volksgezondheid.

EDIT: Onze scherpzinnige commentator wees ons op een anonieme 4chan post van Dec 2020, lang voordat hier iets van bekend werd. De datum doet ons allen afvragen: wist deze persoon te veel?

Lees verder bij de bron: Frontnieuws


JDreport.com publiceert verhalen uit een flink aantal andere "onafhankelijke" nieuwsbronnen, blogs en wat al niet meer. De meningen in dit artikel zijn van de bron en weerspiegelen niet JDreport.com.


0 0 stemmen
Artikelbeoordeling
Abonneer
Laat het weten als er
guest
0 Reacties
Inline feedbacks
Bekijk alle reacties

Herinnering dat corrupte Joe Biden in Oekraïne was om onderzoek naar zijn junkiezoon Hunter Biden stop te zetten

Rusland haalt (kern)wapens uit de loods; Ollongren schept op over Panzerfausten